PDF )   Rev Osteoporos Metab Miner. 2019; 11 (2): 39-45

DOI: 10.4321/S1889-836X2019000300002

Martín-Millán M1,3, Gónzalez-Martín MC2, Ruíz P3, Almeida M4, Ros MA2,5, González-Macías J1,3
1 Departamento de Medicina Interna – Hospital Universitario Marqués de Valdecilla – Santander (España)
2 Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) – Consejo Superior de Investigaciones Científicas – Universidad de Cantabria – Sociedad para el Desarrollo de Cantabria (CSIC-UC-SODERCAN) – Parque Científico y Tecnológico de Cantabria (PCTCAN) – Santander (España)
3 Instituto de Investigación Marqués de Valdecilla (IDIVAL) – Santander (España)
4 Division de Endocrinología y Metabolismo – Centro para Osteoporosis y Enfermedades Metabólicas Óseas – Universidad de Arkansas de Ciencias Médicas – Sistema de Salud Central para Veteranos de Arkansas – Little Rock – Arkansas (EE.UU.)
5 Departamento de Anatomía y Biología Celular – Facultad de Medicina – Universidad de Cantabria – Santander (España)

 

Resumen
La activación de la señalización de Wnt/β-catenina en células del linaje osteoblástico conduce a un aumento en la masa ósea a través de un mecanismo dual: por una parte, aumentando la osteoblastogénesis, y por otra, disminuyendo la osteoclastogénesis. El predominio de un mecanismo sobre otro depende del estado madurativo del osteoblasto en el que produzca la acumulación de β-catenina. La activación de la señalización de Wnt/β-catenina en células del linaje osteoclástico y sus posibles efectos en la regulación de la masa ósea es menos conocida. Estudios previos han demostrado que la ablación condicional de β-catenina en los osteoclastos induce una disminución de la masa ósea asociada a un aumento de los osteoclastos, y este hecho se ha atribuido a un incremento de la osteoclastogénesis. Sin embargo, no se han evaluado otras posibilidades alternativas como que una disminución de la apoptosis normal de los osteoclastos pueda también contribuir al mayor número de los mismos. En este trabajo, para obtener información sobre este hecho, generamos ratones en los que la β-catenina se eliminó selectivamente de las células del linaje de monocito/macrófago utilizando un alelo flanqueado de la β-catenina (Catnbf) junto con la línea de deleción LisozimaMCre (LysMCre). El análisis tridimensional de los huesos de los ratones Catnbf/f;LysM revelaron una disminución significativa del grosor de la cortical femoral, mientras que el hueso trabecular vertebral no se vio afectado. Este fenotipo se asoció con un mayor número de osteoclastos en la superficie ósea. El número de osteoclastos en los cultivos procedentes de los ratones Catnbf/f;LysM fue dos veces mayor que en los cultivos obtenidos de los ratones control. La administración de WNT3a atenuó la formación de osteoclastos inducida por M-CSF y RANKL in vitro. Además, WNT3a promovió la apoptosis de osteoclastos, y este efecto fue contrarrestado, tanto por la presencia de DKK1 como por la ausencia de β-catenina. En conjunto, estos resultados apoyan un efecto autónomo celular de la β-catenina en el osteoclasto, y proporcionan evidencia convincente del papel proapoptótico de β-catenina en estas células.

Palabras clave: hueso, osteoclastos, lisozima M, β-catenina, Wnt, WNT3a.

Introducción
La evidencia acumulada durante los últimos años ha establecido que la vía Wnt/β-catenina es crucial para la formación ósea y el mantenimiento de la homeostasis esquelética [1,2]. Las proteínas Wnt ejercen sus funciones celulares activando diferentes rutas de señalización, comúnmente denominadas vía canónica y vías no canónicas [3]. La primera actúa controlando la cantidad de β-catenina no asociada a cadherina, mientras que las otras rutas no requieren la presencia de β-catenina [4]. En la actualidad, la vía de señalización mediada por la β-catenina es la mejor estudiada y comprendida. La activación de la ruta Wnt/β-catenina comienza en la membrana celular con la unión de ciertos ligandos Wnt, tales como Wnt3a, a los receptores transmembrana de la familia Frizzled. Esta unión recluta el correceptor LRP5/6 (low-density-lipoprotein receptor-related protein 5/6), para formar un complejo ternario que desestabiliza un conglomerado citoplásmico de proteínas que, de lo contrario, fosforilarían la β-catenina del citoplasma para su destrucción en el proteasoma [5-7]. De modo que, tras la unión del ligando al receptor, la β-catenina no es fosforilada ni destruida, y, por lo tanto, puede acumularse en el citoplasma, desde donde se trasladará al núcleo. Allí se une al factor de trascripción TCF/LEF (T-cell factor/lymphoid enhancer factor) e induce la expresión de genes diana [8].
La demostración inicial de la implicación de la vía canónica de Wnt en la osteogénesis fue proporcionada por la identificación de las mutaciones de pérdida de función (LOF) y ganancia de función (GOF) del correceptor LRP5, como responsables del síndrome de osteoporosis-pseudoglioma y del fenotipo hereditario de masa ósea elevada, respectivamente [9-10]. Los fenotipos óseos de estas mutaciones se pudieron reproducir en modelos de ratón con la función del receptor LRP5/6 genéticamente modificada. Estos estudios pusieron de manifiesto el papel osteo-anabolizante de la señalización de Wnt/β-catenina [11]. Más recientemente, estudios realizados con ratones en los que se había manipulado la actividad de la β-catenina en células de linaje osteoblástico han establecido que la β-catenina aumenta la masa ósea a través de diferentes mecanismos dependiendo de la etapa de diferenciación en la que se encuentre la célula osteoblástica [12-14]. De forma que la GOF de la β-catenina exclusivamente en las células precursoras estimula su proliferación y maduración, pero suprime el destino alternativo hacia la diferenciación condrocítica, produciendo así un aumento de la masa ósea [15]. Por otro lado, cuando la GOF de β-catenina se produce en una etapa posterior de la diferenciación, se logra también una masa ósea elevada, pero esta ocurre a espensas de un mecanismo indirecto, esto es, la β-catenina induce la expresión de osteoprotegerina (OPG) en el osteoblasto, y la OPG atenúa la osteoclastogénesis [16,17].
La participación indirecta de los osteoclastos como mediadores de algunos de los efectos de la señalización Wnt/β-catenina en las células de estirpe osteoblástica, planteó la cuestión de si esta vía podría tener tambien un papel directo en la función de los osteoclastos cuando se activa en ellos. Otero et al. [18] y Albers et al. [19] eliminaron β-catenina de los precursores de osteoclastos utilizando el modelo de ratón LisozimaMCre (LysMCre), y encontraron una disminución de la masa ósea en el compartimiento trabecular, con un aumento paralelo en el número de osteoclastos, mostrando así que la β-catenina de los osteoclastos está, de hecho, implicada en la homeostasis ósea. Estos autores, atribuyeron el aumento del número de osteoclastos a un incremento exclusivo en la osteoclastogénesis, sin considerar posibles efectos sobre la apoptosis. Creemos que es importante aclarar esta cuestión, ya que la β-catenina es parte de una vía de señalización que actualmente es considerada como un objetivo terapéutico interesante. Para obtener una idea de este problema, hemos generado un modelo de ratón similar, en el que hemos analizado su fenotipo, y tambien posibles efectos sobre la apoptosis de los osteoclastos.

Material y métodos
1. Reactivos
La proteina WNT3a, la proteina Dickkopf 1 (DKK1), el factor estimulante de colonias de macrófagos (M-CSF) y el activador de receptor soluble de proteínas recombinantes del ligando kappa-B de factor nuclear (sRANKL) se adquirieron de R&D Systems (Minneapolis, EE.UU.).

2. Ratones mutantes
Todos los procedimientos con animales se llevaron a cabo de acuerdo con las normas de la Unión Europea y los principios 3R. Los experimentos fueron revisados y aprobados por el Comité de Bioética de la Universidad de Cantabria. El ratón con el alelo de β-catenina flaqueado por la secuencia flox [20] y la línea LysMCre [21] han sido descritos previamente y se obtuvieron del Laboratorio Jackson. Los ratones se genotiparon mediante PCR, utilizando el ADN genómico extraído de biopsia de la cola. Los cebadores utilizados para la detección de LysMCre fueron los siguientes; foward GCGGTCTGGCAGTAAAAACTATC y reverse: GTGAAACAGCATTGCTGTCACTT, y el tamaño del producto 102 pb. Reverse: CACCATGTCCTCTGTCTATTC, y el tamaño del producto en este caso sería de 324 pb. Los ratones experimentales se generaron mediante una estrategia de apareamiento consistente en dos pasos. Los ratones heterocigotos LysMCre fueron cruzados con ratones cuyo gen de la β-catenina estaba flanqueado por secuencias flox en homocigosis (β-cateninf/f). Para generar ratones homocigóticos para el alelo condicional de β-catenina con y sin el alelo Cre, los ratones β-catenin f / +; LysMCre se cruzaron con los ratones β-cateninf /f.

3. Micro-TAC
Se realizó un análisis de micro-TAC de la quinta vértebra lumbar después de disecar los huesos, limpiarlos, fijarlos en etanol, cargarlos en tubos de exploración de 12,3 mm de diámetro y obtener una imagen (μCT40, Scanco Medical. Basserdorf, Suiza). Los escaneos se integraron en imágenes voxel 3-D (matrices de 1.024 x 1.024 píxeles para cada pila planar individual) y se usó un filtro gaussiano (sigma=0,8, soporte=1) para reducir el ruido de la señal. Se aplicó un umbral de 200 a todos los escaneos analizados. Los escaneos se realizaron a una resolución media (E=55 kVp, I=145 μA, tiempo de integración=200 ms). Se escaneó todo el cuerpo vertebral con una orientación transversal que excluía los pedículos y los procesos articulares. El análisis manual excluyó el hueso cortical del análisis. Todas las mediciones trabeculares se realizaron dibujando manualmente contornos cada 10 a 20 cortes y utilizando el conteo de voxel para el volumen óseo por volumen de tejido y los índices de transformación de distancia de relleno esférico sin suposiciones sobre la forma del hueso como varilla o placa para microarquitectura trabecular. El espesor cortical se midió en la mitad de la diáfisis femoral.

4. Histología ósea
Las vértebras lumbares (L1, L2 y L3) y el fémur izquierdo se fijaron en paraformaldehído al 4% durante toda la noche a 4ºC y se descalcificaron durante ocho a nueve días en EDTA al 9% (pH 7,4) antes de la inclusión en parafina. El examen histomorfométrico se realizó en secciones longitudinales de 7 μm del fémur para hueso cortical y en las secciones frontales de las vértebras para hueso esponjoso.

5. Cultivos celulares
Para cuantificar las células progenitoras de los osteoclastos, la médula ósea (MO) se purgó de los huesos largos y se sembró a una densidad de 50.000 células/cm2 en placas de 48 pocillos. Tras permanecer 4-5 días en la placa de cultivo con medio α-MEM (Invitrogen), suplementado con 10% de SFB, 1% de PSG, 30 ng/ml de M-CSF y 30 ng/ml de sRANKL (R & D Systems), los osteoclastos se fijaron con 10% de formalina durante 15 min y teñida para fosfatasa ácida resistente a tartrato (TRAP). Los osteoclastos se cuantificaron teniendo en cuenta las células multinucleares y positivas para la tinción de TRAP. Para el resto de los cultivos, se usaron células de médula ósea purificadas, es decir no adheridas a la placa. Los macrófagos y osteoclastos se desarrollaron a partir de células de la médula ósea (MO) no adheridas a la placa de cultivo, y cultivadas durante 4 días en presencia de M-CSF (130 ng/ml) para obtener macrófagos, o durante 4 días en presencia de M-CSF (30 ng/ml) y 30 ng/ml de RANKL para obtener osteoclastos.

6. PCR cuantitativa en tiempo real (Quantitative real-time PCR, qRT-PCR)
El ARN total se extrajo con reactivos TRIzol (Life Tecnologies). Se usó 1 μg de ARN total para producir ADNc de primera cadena usando la enzima m-MLV RT (Invitrogen). La qRT-PCR se llevó a cabo utilizando PreMix Ex taq (Takara) y los datos se analizaron utilizando el software Biorad. Los cebadores y las sondas para β-catenina [Mm01350385_g1 (fam)] y gapdh [Mm99999915_g1 (vic)] fueron fabricados por el servicio TaqMan Gene Expression Assays (Applied Biosystems). Los niveles relativos de expresión de ARNm se normalizaron con el gen de la proteína ribosómica S2 mediante el método ΔCt [22].

7. Analisis por Western blot
Los niveles de proteína de β-catenina y β-actina se analizaron usando un anticuerpo monoclonal de ratón que reconoce β-catenina (BD Biosciences), y un anticuerpo monoclonal de ratón que reconoce β-actina (Sigma-Aldrich).

8. Analisis de apoptosis
Se obtuvieron osteoclastos derivados de células de la MO no adheridas a la placa de cultivo extraídos de los ratones Catnbf/f;LysMCre y sus controles. Una vez desarrollados los osteoclastos en la placa de cultivo se trataron con WNT3a. Tras 24 horas de tratamiento, los cultivos se fijaron y se sometieron a tinción de TUNEL y TRAP. Se cuantificaron el número total de osteoclastos y el número de osteoclastos apoptóticos en cada placa. Se consideraron apoptóticos cuando al menos uno de sus núcleos era TUNEL positivo. El método TUNEL se realizó utilizando el kit de detección de fragmentación de ADN FragEL (EMD Chemicals. San Diego, California, EE.UU.) antes de la tinción para TRAP. Se enumeraron las células multinucleares TRAP positivas y TUNEL positivas.
La actividad de la caspasa-3 se midió determinando la degradación del sustrato fluorométrico DEVD (Biomol Research Laboratories, Plymouth Meeting. Pensilvania, EE.UU.), y se midió la concentración de proteína usando un kit compatible con detergente Bio-Rad (Bio-Rad Laboratories, Hercules. California, EE.UU.).

9. Analisis estadístico
Todos los datos se informan como la media ± desviación estándar. Los valores medios de cada grupo se compararon mediante la prueba t de Student de dos colas.

Resultados
1. La eliminación específica de la β-catenina de los precursores de los osteoclastos
La inactivación condicional de la β-catenina (Catnb) en células de linaje osteoclástico se realizó cruzando ratones que albergaban un alelo de β-catenina floxeado (Catnbf) [20] con ratones que expresaban la enzima Cre recombinasa bajo el control de los elementos reguladores del gen LisozimaM (LysMCre) [21]. Esta línea Cre induce la recombinación del alelo floxeado específicamente en las células del linaje monocito-macrófago y neutrófilos. A partir de este cruce, se generaron dos cohortes (machos y hembras) de animales; una cohorte de experimentación, con genotipo Catnbf/f;LysMCre y otra control con genotipo Catnbf/f.
Los ratones Catnbf/f;LysMCre nacieron en la proporción mendeliana esperada, con peso corporal similar (Figura 1A) a los controles de la misma camada y no mostraron ningún fenotipo evidente. La escisión del gen de β-catenina se confirmó por qRT-PCR. Los niveles de ARNm de β-catenina se analizaron en cultivos ex vivo de macrófagos y osteoclastos derivados de médula ósea (MO). Los macrófagos y osteoclastos obtenidos de ratones Catnbf/f;LysMCre exhibieron una disminución del 70% y del 60% en la expresión de β-catenina, respectivamente (Figura 1B). Atribuimos la eficacia limitada de la recombinación a la presencia de células de linajes distintos al mieloide en la placa de cultivo que expresaban niveles normales de β-catenina. Como se esperaba, el nivel de expresión de ARNm de β-catenina en riñón, hígado y bazo fue indistinguible entre los dos genotipos (Figura 1C).

2. Los animales carentes de β-catenina en los precursores de los osteoclastos presentan menor grosor del hueso cortical
A las 28 semanas de vida se sacrificó una cohorte de 15 animales por sexo y genotipo y se examinó la arquitectura ósea de la quinta vértebra lumbar y el fémur derecho mediante micro-TC. El análisis reveló un grosor reducido del hueso cortical (Figura 2A), tanto en los machos como en las hembras Catnbf/f;LysMCre. Sin embargo, la ausencia de β-catenina en los precursores de los osteoclastos no alteró significativamente la masa ósea trabecular, ni en las vértebras, ni en el fémur (Figura 2B). Tampoco se vio afectado el espacio intertrabecular, el grosor trabecular y el número de trabeculas (no mostrado). Estos resultados sugieren que la señalización de Wnt/β-catenina en los osteoclastos es importante para el mantenimiento de la masa ósea cortical.

3. Los ratones Catnbf/f;LysMCre presentan más osteoclastos en el endostio y más progenitores osteoclásticos en la médula ósea (MO)
A continuación, quisimos cuantificar el número de osteoclastos presentes en la superficie del hueso cortical. Lo que encontramos fue que, de acuerdo con un espesor cortical disminuido, el número de osteoclastos en la superficie endocortical del fémur de los ratones Catnbf/f;LysMCre estaba aumentado, en comparación con los animales control (Figura 3A). El hueso trabecular vertebral parecía mostrar la misma tendencia. Sin embargo, la diferencia no fue significativa (p=0,06).

Para examinar si el mayor número de osteoclastos en el hueso podría explicarse por un aumento de la osteoclastogénesis, se cuantificó el número de estos progenitores en la MO. Con este propósito, las células de la MO obtenidas de los huesos largos de ratones de 28 semanas de edad se cultivaron en presencia de RANKL y M-CSF durante 5 días. Se utilizaron tres ratones por genotipo y se realizaron determinaciones por triplicado para cada uno de ellos. El número de osteoclastos que se desarrolló en los cultivos procedentes de ratones Catnbf/f;LysMCre mostraron una morfología normal (Figura 3B). Sin embargo, la cantidad fue dos veces mayor que en los cultivos procedentes de la camada control (426±18 por pocillo frente a 238±77, p=0,015) (Figura 3B). Este resultado sugiere que la señalización de Wnt/β-catenina en los precursores de osteoclastos y su descendencia atenúa la cantidad de osteoclastos maduros.
4. El efecto proapoptótico de WNT3a requiere la presencia de β-catenina
Para examinar los mecanismos celulares a través de los cuales Wnt/β-catenina disminuía el número de osteoclastos, primero determinamos si la adición de WNT3a a la placa de cultivo de los precursores de osteoclastos interfería con el desarrollo de los mismos. Como se muestra en la figura 4A, la presencia de WNT3a en el medio de cultivo disminuyó el número de osteoclastos inducidos por la presencia de M-CSF y RANKL. Además, este hecho parecía ser dosis dependiente. El análisis por Western blot confirmó un aumento de los niveles de β-catenina en los osteoclastos expuestos a WNT3a (Figura 4B). Además, el tratamiento del cultivo con DKK1, un inhibidor del correceptor LRP5/6 evitó el aumento de β-catenina inducido por WNT3a. El conjunto de estos hallazgos indica que WNT3a inhibe el desarrollo de los osteoclastos mediante la estimulación de la vía canónica de Wnt.

Es bien sabido que la vida media de los osteoclastos es muy breve, y que mueren por apoptosis. A continuación examinamos el efecto de la señalización de Wnt en la apoptosis de los macrófagos y de los osteoclastos. Como se muestra en la figura 4C, se determinó la apoptosis midiendo la actividad de la caspasa-3 tras la administración de dosis crecientes de WNT3A a los cultivos de macrófagos y de osteoclastos. Los resultados mostraron que WNT3a inducía la apoptosis tanto en los macrófagos, como en los osteoclastos. El efecto proapoptótico de WNT3 era también dependiente de la dosis utilizada. El efecto de WNT3a sobre la apoptosis de los osteoclastos también se analizó mediante TUNEL (Figura 4D), y, de la misma forma que se observó en el experimento anterior, vimos que el tratamiento con WNT3a aumentaba el porcentaje de osteoclastos TUNEL positivos. Sin embargo, la presencia de WNT3 no tuvo ningun efecto deletéreo sobre los cultivos de osteoclastos obtenidos de los ratones Catnbf/f;LysMCre (Figura 4D), carentes de β-catenina. Igualmente, la adición de DKK1 a los cultivos anuló las acciones proapoptóticas de WNT3a (Figura 4D), indicando que el efecto proapoptótico de WNT3a requiere la presencia de β-catenina. En conjunto, estos resultados apoyan la hipótesis de que la vía de señalización canónica de Wnt/β-catenina ejerce efectos proapoptóticos en los osteoclastos.

Discusión
En este trabajo hemos analizado las características óseas de animales que carecen de β-catenina en las células del linaje monocito/macrófago, que son los precursores de los osteoclastos. Estos animales muestran un grosor cortical reducido que se asocia a mayor cantidad de osteoclastos en la superficie del endostio y un mayor número de progenitores osteoclásticos en la MO. Además, demostramos que la estimulación de la señalización de Wnt/β-catenina en los osteoclastos atenúa la cantidad de osteoclastos desarrollados inducida por la presencia de M-SCF y RANKL, y promueve su apoptosis.
Otero et al. [18] y Albers et al. [19] utilizaron la misma línea LysMCre para eliminar la β-catenina de los precursores de osteoclastos. Ambos grupos describieron una disminución de la masa ósea en el compartimiento trabecular, con un aumento paralelo en el número de osteoclastos, que atribuyeron a un aumento exclusivo de la osteoclastogénesis. Sin embargo, no abordaron la posibilidad de que una disminución en la apoptosis osteoclástica estuviera también implicada. En nuestro estudio, demostramos un aumento de los osteoclastos en la superficie endocortical del hueso femoral, y un aumento en el número de osteoclastos generados en los cultivos celulares obtenidos de animales Catnbf/f;LysMCre, en comparación con los controles. También observamos que la estimulación de la señalización de Wnt/β-catenina en las células de MO obtenidas de ratones salvajes disminuye el número de osteoclastos desarrollados en la placa de cultivo. Nuestros resultados, por lo tanto, coinciden con los de Otero et al. [18] y Albers et al. [19]. Además, nosotros hemos abordado la cuestión de una posible implicación de la apoptosis osteoclástica como parte del mecanismo de acción subyacente a los hallazgos fenotípicos observados. Nuestros hallazgos, en este sentido, indican que la disminución en el número de osteoclastos inducida por la activación de Wnt/β-catenina se debe claramente a la estimulación de la apoptosis de los macrófagos y osteoclastos.
Varios estudios han demostrado que alteraciones en la supervivencia de los osteoclastos modifican la masa ósea [23-26]. De hecho, está bien establecido que los estrógenos protegen el esqueleto, en parte, a través de los efectos proapoptóticos sobre los osteoclastos [27,28]. La eliminación del receptor de estrógeno alfa en las células del linaje osteoclástico, similar a la eliminación de β-catenina, aumenta el número de osteoclastos y disminuye la masa ósea. A diferencia de los estrógenos, los glucocorticoides promueven la pérdida de masa ósea, al menos en parte, a través de la prolongación de la vida útil de los osteoclastos [29].
Las proteínas Wnts ejercen un efecto positivo sobre la supervivencia de los osteoblastos y también sobre los progenitores osteoblásticos que aún no se han comprometido [30]. Esta acción antiapoptótica de las proteínas Wnts sobre los osteoblastos se ha postulado como uno de los mecanismos por los cuales la señalización de Wnt aumenta la masa ósea [31]. Aunque la vía Wnt/β-catenina es mejor conocida por sus efectos pro-supervivencia, también puede ejercer acciones proapoptóticas. Por ejemplo, la apoptosis de los cardiomioblastos de rata inducida por la reoxigenación tras la hipoxia está regulada por WNT3a, a través de un mecanismo dependiente de β-catenina [32]. Además, en línea con estos hallazgos, la señalización de Wnt/β-catenina disminuye la invasividad celular del melanoma [33], potenciando la expresión de proteínas proapoptóticas, como BIM y PUMA, y disminuyendo los niveles de proteínas antiapoptóticas, como MCL [34].
En nuestro estudio, mediante el análisis de actividad de la caspasa, o ensayos de TUNEL, hemos encontrado que WNT3a induce la apoptosis de los osteoclastos. Este efecto es contrario a su efecto de pro-supervivencia previamente mencionado sobre los osteoblastos [30]. Curiosamente, al igual que Wnts, los estrógenos y los glucocorticoides ejercen efectos opuestos sobre la apoptosis de osteoblastos y osteoclastos [29,35,36].
Para concluir, nuestros hallazgos sugieren que los efectos inhibidores de la β-catenina sobre los osteoclastos se deben a mecanismos proapoptóticos y apoyan la hipótesis de que los efectos osteoprotectores de la vía canónica de Wnt son también el resultado de la acción directa a través de las células del linaje osteoclástico. Por lo tanto, la señalización Wnt/β-catenina en el entorno óseo tiene un efecto osteoprotector ejercido tanto a través de las células de linajes osteoblásticos como osteoclásticos.

Agradecimientos: Reconocemos la excelente asistencia técnica de Marisa Junco y Mar Rodríguez y el apoyo de todos los miembros del Laboratorio de Ros.

Financiación: MCG-M fue beneficiario de la beca JAE-Doc 2008 cofinanciada por FSE. Este trabajo fue apoyado por la subvención ISCIII PI12/01405 a JGM, BFU2011-24972 a MAR del gobierno español y R01 AR56679 a MA del National Institutes of Health, EE.UU.

Conflicto de intereses: Lo autores declaran no tener conflicto de intereses

 

Bibliografía

1. Hartmann C. A Wnt canon orchestrating osteoblastogenesis. Trends Cell Biol. 2006;16(3):151-8.
2. Baron R, Kneissel M. WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nat Med. 2013;19(2):179-92.
3. Eisenmann DM. Wnt signaling. WormBook. 2005 Jun 25:1-17.
4. Gómez-Orte E, Sáenz-Narciso B, Moreno S, Cabello J. Multiple functions of the noncanonical Wnt pathway. Trends Genet. 2013;29(9):545-53.
5. Tamai K, Semenov M, Kato Y, Spokony R, Liu C, Katsuyama Y, et al. LDL-receptor-related proteins in Wnt signal transduction. Nature. 2000;407(6803):530-5.
6. He X, Semenov M, Tamai K, Zeng X. LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development. 2004; 131:1663-77.
7. Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, et al. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell. 2002; 108(6):837-47.
8. Bienz M, Clevers H. Armadillo/beta-catenin signals in the nucleus–proof beyond a reasonable doubt? Nat Cell Biol. 2003;5(3):179-82.
9. Gong Y, Slee RB, Fukai N, Rawadi G, Roman-Roman S, Reginato AM, et al. Osteoporosis-Pseudoglioma Syndrome Collaborative Group. LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell. 2001;107(4):513-23.
10. Boyden LM, Mao J, Belsky J, Mitzner L, Farhi A, Mitnick MA, et al. High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med. 2002;346:1513-21.
11. Zylstra CR, Wan C, VanKoevering KK, Sanders AK, Lindvall C, Clemens TL, et al. Gene targeting approaches in mice: assessing the roles of LRP5 and LRP6 in osteoblasts. J Musculoskelet Neuronal Interact. 2008;8(4):291-3.
12. Hu H, Hilton MJ, Tu X, Yu K, Ornitz DM, Long F. Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development. 2005;132:49-60.
13. Day TF, Guo X, Garrett-Beal L, Yang Y. Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell. 2005;8:739-50.
14. Hill TP, Spater D, Taketo MM, Birchmeier W, Hartmann C. Canonical Wnt/ beta-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev Cell. 2005;8:727-38.
15. Rodda SJ, McMahon AP. Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development. 2006;133:3231-44.
16. Glass DA, Bialek P, Ahn JD, Starbuck M, Patel MS, Clevers H, et al. Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev Cell. 2005;8:751-64.
17. Kramer I, Halleux C, Keller H, Pegurri M, Gooi JH, Weber PB, et al. Mol Osteocyte Wnt/beta-catenin signaling is required for normal bone homeostasis. Cell Biol. 2010;30(12):3071-85.
18. Otero K, Shinohara M, Zhao H, Cella M, Gilfillan S, Colucci A, et al. TREM2 and β-catenin regulate bone homeostasis by controlling the rate of osteoclastogenesis. J Immunol. 2012;188(6):2612-21.
19. Albers J, Keller J, Baranowsky A, Beil FT, Catala-Lehnen P, Schulze J, et al. Canonical Wnt signaling inhibits osteoclastogenesis independent of osteoprotegerin. J Cell Biol. 2013;200(4):537-49.
20. Brault V, Moore R, Kutsch S, Ishibashi M, Rowitch DH, McMahon AP, et al. Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development. 2001;128(8):1253-64.
21. Clausen BE, Burkhardt C, Reith W, Renkawitz R, Förster I. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 1999;8(4):265-77.
22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8.
23. Jilka RL. Biology of the basic multicellular unit and the pathophysiology of osteoporosis. Med Pediatr Oncol. 2003;41(3):182-5.
24. Weinstein RS, Manolagas SC. Apoptosis and osteoporosis. Am J Med. 2000; 108(2):153-64.
25. Manolagas SC. Birth and death of bone cells: basic regulatory mechanisms and implications for the pathogenesis and treatment of osteoporosis. Endocr Rev. 2000;21(2):115-37.
26. Xing L, Boyce BF. Regulation of apoptosis in osteoclasts and osteoblastic cells. Biochem Biophys Res Commun. 2005;328(3):709-20.
27. Nakamura T, Imai Y, Matsumoto T, Sato S, Takeuchi K, Igarashi K, et al. Estrogen prevents bone loss via estrogen receptor alpha and induction of Fas ligand in osteoclasts. Cell. 2007;130(5):811-23.
28. Martin-Millan M, Almeida M, Ambrogini E, Han L, Zhao H, Weinstein RS, et al. The estrogen receptor-alpha in osteoclasts mediates the protective effects of estrogens on cancellous but not cortical bone. Mol Endocrinol. 2010;24(2):323-34.
29. Jia D, O’Brien CA, Stewart SA, Manolagas SC, Weinstein RS. Glucocorticoids act directly on osteoclasts to increase their life span and reduce bone density. Endocrinology. 2006;147(12):5592-9.
30. Almeida M, Han L, Bellido T, Manolagas SC, Kousteni S. Wnt proteins prevent apoptosis of both uncommitted osteoblast progenitors and differentiated osteoblasts by beta-catenin-dependent and -independent signaling cascades involving Src/ERK and phosphatidylinositol 3-kinase/AKT. J Biol Chem. 2005;280(50):41342-51.
31. Krishnan V, Bryant HU, Macdougald OA. Regulation of bone mass by Wnt signaling. J Clin Invest. 2006;116(5):1202-9.
32. Zhang Z, Deb A, Zhang Z, Pachori A, He W, Guo J, et al. Secreted frizzled related protein 2 protects cells from apoptosis by blocking the effect of canonical Wnt3a. J Mol Cell Cardiol. 2009;46(3): 370-7.
33. Smalley KS, Contractor R, Haass NK, Kulp AN, Atilla-Gokcumen GE, Williams DS, et al. An organometallic protein kinase inhibitor pharmacologically activates p53 and induces apoptosis in human melanoma cells. Cancer Res. 2007;67(1):209-17.
34. Zimmerman ZF, Kulikauskas RM, Bomsztyk K, Moon RT, Chien AJ. Activation of Wnt/β-catenin signaling increases apoptosis in melanoma cells treated with trail. PLoS One. 2013;8(7):e69593.
35. Manolagas SC, O’Brien CA, Almeida M. The role of estrogen and androgen receptors in bone health and disease. Nat Rev Endocrinol. 2013;9(12):699-712.
36. O’Brien CA, Jia D, Plotkin LI, Bellido T, Powers CC, Stewart SA, et al. Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology. 2004;145(4):1835-41.