PDF )   Rev Osteoporos Metab Miner. 2019; 11 (2): 46-54

DOI: 10.4321/S1889-836X2019000300003

Varela-Eirín M1, Varela-Vázquez A1, Blanco A2, Caeiro JR3, Mayán MD1
1 Grupo de Investigación Traslacional en Comunicación y Señalización Celular (CellCOM) – Instituto de Investigación Biomédica de A Coruña (INIBIC) – Servicio Gallego de Salud (SERGAS) – Universidad de A Coruña (UDC) – A Coruña (España)
2 Tecnologías Principales de Citometría de Flujo del Instituto Conway de Investigación Biomédica y Biomolecular – Universidad de Dublín – Dublín (Irlanda)
3 Departamento de Cirugía Ortopédica y Traumatología – Complejo Hospitalario Universitario de Santiago de Compostela (CHUS) – Universidad de Santiago de Compostela (USC) – Santiago de Compostela (España)

 

Resumen
Introducción: La artrosis (OA) es una enfermedad musculoesquelética degenerativa que afecta aproximadamente al 13% de la población occidental. A día de hoy no existe un tratamiento eficaz que evite el progreso de la misma o facilite la regeneración del cartílago articular. La conexina43 (Cx43) es una proteína transmembrana que se encuentra en niveles elevados en el cartílago y en la membrana sinovial de pacientes con OA. Esta proteína forma canales que permiten el intercambio de moléculas e iones entre dos células en contacto o entre la célula y su entorno, denominados uniones comunicantes (UCs) y hemicanales, respectivamente. En este estudio se investigó la función de la Cx43 y de las UCs en la degradación del cartílago articular de pacientes con OA.
Material y métodos: Se han aislado condrocitos primarios del cartílago de donantes OA y sanos. Se evaluaron los niveles proteicos mediante Western blot, inmunofluorescencia y citometría de flujo. La expresión génica se ha evaluado mediante RT-qPCR, mientras que la comunicación celular se estudió mediante el ensayo scrape loading/dye transfer. La senescencia celular se evaluó midiendo la actividad de la β-galactosidasa mediante citometría celular o microscopía.
Resultados: Los resultados obtenidos indican que la sobreactividad de la Cx43 y de la comunicación intercelular a través de UCs detectadas en OA están implicadas con el progreso de la enfermedad al activar procesos de desdiferenciación celular hacia un estado inmaduro y senescencia celular. Utilizando condrocitos en cultivo aislados del cartílago de donantes con OA hemos demostrado que el incremento de la Cx43 activa factores implicados en la transición epitelio-mesénquima (TEM), como el factor de transcripción Twist-1. El incremento en el número de células desdiferenciadas y con altos índices de proliferación celular desencadena en senescencia celular vía p53/p16INK4a, activando el fenotipo secretor asociado a senescencia (SASP, del inglés Senescence-Associated Secretory Phenotype) que incluye la síntesis y liberación de factores inflamatorios como la interleuquina 6 (IL-6). La disminución de los niveles de la Cx43 utilizando pequeñas moléculas como la oleuropeína o técnicas de edición genética como CRISPR/Cas9 revirtió el proceso dando lugar a re-diferenciación celular, mejorando el fenotipo celular con incremento en proteínas implicadas en formación del tejido y diminuyendo la síntesis de MMPs y del componente inflamatorio y senescencia.
Conclusiones: La disminución de la Cx43 en condrocitos artrósicos restaura regeneración tisular, por activación de re-diferenciación celular y disminución de senescencia. Estos resultados corroboran el uso de la Cx43 como una diana terapéutica eficaz para restaurar regeneración del cartílago en pacientes con OA y evitar la progresión de la enfermedad.

Palabras clave: conexina43, artrosis, desdiferenciación, senescencia, regeneración tisular.

Introducción
La artrosis (OA) es una enfermedad crónica que se caracteriza por una degradación progresiva del cartílago articular que recubre la superficie de las articulaciones sinoviales, que permiten el movimiento del esqueleto sin que se produzca dolor. Los condrocitos de pacientes con artrosis sufren cambios en el fenotipo asociados con un incremento en la actividad catabólica e inflamatoria [1,2], junto con un incremento en la senescencia celular y del fenotipo secretor asociado a senescencia (SASP) [2,3]. Nuestro grupo de investigación ha demostrado previamente que los condrocitos en el cartílago articular poseen largas proyecciones citoplasmáticas que atraviesan la matriz extracelular (MEC) [4], capaces de formar conexiones y uniones comunicantes (UCs) a través de canales de conexina-43 (Cx43) [4,5]. En el año 2013, nuestro grupo de investigación publicó resultados relevantes asociados con alteraciones de la actividad de la Cx43 en artrosis, indicando que desde estadios muy tempranos de la enfermedad existe un incremento y cambios en la localización de la proteína en el cartílago de pacientes con artrosis [6]. Posteriormente, utilizando modelos animales observamos que el dominio C-terminal de la Cx43 juega un papel fundamental en la estructura y composición del cartílago articular [7].
La Cx43 está implicada en procesos de regeneración tisular en piel, corazón y en otros tejidos [8,9]. Varios autores han puesto de manifiesto que la artrosis podría incluirse dentro de enfermedades relacionadas con alteraciones en el proceso de regeneración tisular [10,11]. De hecho, los condrocitos artrósicos sufren desdiferenciación celular y presentan mayores niveles de proliferación celular [12,13], probablemente debido a un intento de reparar el daño producido en el cartílago. La presencia de condrocitos desdiferenciados de forma crónica, desencadena la sustitución progresiva de cartílago articular por fibrocartílago asociado a degeneración y pérdida funcional en la articulación [14-19]. En esta línea de trabajo, es importante destacar que el uso de moléculas que promueven la condrogénesis, y por tanto la re-diferenciación del condrocito, poseen un efecto protector en modelos de OA [20]. Estas moléculas reciben el nombre de fármacos modificadores de la OA (DMOADs, del inglés Disease-Modifying Osteoarthritis Drugs), entre los que se encuentra la kartogenina, la cual se ha visto que promueve la condrogénesis en células madre mesenquimales humanas y también mejora la regeneración del cartílago en ratones sometidos a daño inflamatorio y/o mecánico en la articulación [20]. Otras DMOADs, como TD-198946, TAK-778 o AG-041R, también se han descrito como moléculas promotoras de la condrogénesis con potencial terapéutico en reparación del cartílago articular [21-23]. El cartílago de pacientes con OA presenta niveles elevados de la Cx43 junto con alteraciones en el proceso de regeneración tisular. Nuestro objetivo ha sido estudiar si alteraciones en la actividad de la Cx43 y de la comunicación intercelular a través de UCs estarían relacionadas con cambios en el fenotipo celular y senescencia asociados a progreso de la enfermedad.

Material y métodos
Recogida de muestras y cultivo celular
Las muestras de cartílago se recogieron y procesaron como se ha descrito previamente [4] después de que los donantes firmaran el consentimiento informado y de la aprobación del Comité Ético de Investigación Clínica de Galicia (C.0003333, 2012/094 y 2015/029). Se utilizó la línea celular de condrocitos humanos T/C-28a2, procedente de condrocitos sanos primarios que fueron transfectados con la partícula vírica SV40, generosamente donada por la Dra. Goldring (The Hospital for Special Surgery, Nueva York – EE.UU.). Los condrocitos se cultivaron en medio DMEM (del inglés Dulbecco’s modified Eagle’s Medium, Lonza) suplementado con un 10% de suero bovino fetal (FBS, del inglés Fetal Bovine Serum, Gibco) y una mezcla de antibióticos al 1% (P/S; Penicilina 100 U/mL, Estreptomicina 100 µg/mL, Gibco).

Western blot
El análisis de niveles proteicos totales o nucleares se llevó a cabo mediante la técnica de Western blot. Cantidades equivalentes de proteínas fueron separados en geles de acrilamida desnaturalizantes al 10% y transferidas a una membrana de fluoruro de polivinilideno (PVDF). Tras el bloqueo con leche desnatada diluida en tris salino tamponado (TBS), las membranas fueron incubadas toda la noche a 4ºC con anticuerpos primarios anti α-tubulina (Sigma-Aldrich, T9026), Cx43 (Sigma-Aldrich, C6129) Twist-1 (SCBT, sc-81417), antígeno nuclear de proliferación celular o PCNA (SCBT, sc-56), p53 (SCBT, sc-126), factor nuclear potenciador de las cadenas ligeras kappa de las células B activadas o NF-Kß (SCBT, sc-8008) o Lamina A (SCBT, sc-20680). Después de la incubación con el anticuerpo primario, se lavaron las membranas con TBS y se incubaron con sus correspondientes anticuerpos secundarios marcados con peroxidasa de rábano (HRP) durante 1 hora a temperatura ambiente. Una vez eliminado el exceso de anticuerpo con TBS la señal se visualizó en una cámara de revelado LAS-3000 (Fujifilm).

Immunofluorescencia
Para la detección de proteínas por inmunofluorescencia, las células previamente fijadas con paraformaldehído al 2% fueron incubadas con glicina 0,1 M (Sigma-Aldrich) durante 10 minutos. Posteriormente, se realizó una permeabilización de las membranas celulares con Triton X-100 (Sigma-Aldrich) al 0,2% en tampón fosfato salino (PBS), durante 10 minutos. Las uniones inespecíficas fueron bloqueadas mediante una incubación de 30 minutos con 1% de suero de albúmina bovina (BSA, Sigma-Aldrich) en PBS. Posteriormente, las células fueron incubadas con el anticuerpo primario durante 1 hora a temperatura ambiente. Tras tres lavados de 10 minutos con PBS, las células fueron incubadas con el anticuerpo secundario marcado con un fluoróforo durante 1 hora, en oscuridad y a temperatura ambiente. Se realizaron otros tres lavados de 10 minutos con PBS, seguido de una tinción de núcleos con 4′,6-diamidino-2-fenilindol –DAPI– (Sigma-Aldrich). Las imágenes se realizaron en un microscopio Olympus BX61 con un cámara DP71.

Inmunohistoquímica
Las micromasas de condrocitos fueron embebidas en O.C.T.TM (Optimum Cutting Temperature) y cortadas en secciones de 4 µm, las cuales fueron incubadas con peróxido de hidrógeno al 3% durante 10 minutos. Las secciones fueron incubadas con el anticuerpo primario anti-colágeno tipo II durante 1 hora a temperatura ambiente. Tras realizar tres lavados con PBS, las secciones se incubaron con OptiView HQ Universal Linker (Roche) durante 10 minutos. Posteriormente, se incubaron durante 8 minutos con OptiView HRP Multimer (Roche), se lavó el exceso de reactivo y se reveló la señal en una solución de DAB al 0,1% en peróxido de hidrógeno al 0,02%.

Citometría de flujo
Para la medida de los niveles proteicos mediante citometría de flujo, las células fueron fijadas con paraformaldehído al 1% durante 10 minutos, se lavaron con una solución de lavado (PBS + 0.5% BSA + 2mM EDTA), y se tiñeron con anticuerpos anti Cx43-APC (R&D Systems, FAB7737A), endoglina o CD105 – PE (Immunostep, 105PE-100T) o antígeno CD166 (ALCAM) o CD166- APC (Immunostep, 1399990314). El análisis se llevó a cabo en un citómetro FACSCaliburTM.

Transfección celular
La línea celular T/C-28a2 fue transfectada mediante electroporación con el kit Amaxa® Cell Line Nucleofector® kit V (Lonza) en un aparato Cell Line NucleofectorTM (Lonza). Se electroporó 1 millón de células con 3 µg del plásmido pIRESpuro2 (Clontech) que contiene la secuencia del gen de la Cx43 humana, generosamente donado por la Dra. Arantxa Tabernero (INCYL, Universidad de Salamanca, España). A las 24 horas el medio fue cambiado por medio con P/S y antibiótico para la selección de los condrocitos que contienen el plásmido.
Por otro lado, también se llevó a cabo la electroporación de la línea T/C-28a2 con un vector CRISPR (modificado de Addgene #48138) con la enzima Cas9 VP12 (derivada de Addgene #72247) unido a un marcador GFP (proteína verde fluorescente), con una guía que tiene como diana 20 nucleótidos del gen de la Cx43. Este vector ha sido generosamente donado por el Dr. Trond Aasen (Instituto de Investigación Vall d’Hebron, Universidad Autónoma de Barcelona, España). Células electroporadas y positivas para GFP fueron sembradas en una placa de 96 pocillos y expandidas como clones.

Expresión génica
Los niveles de expresión génica se llevaron a cabo mediante la extracción de ARNm con TRIzol (Invitrogen), retrotranscripción con el kit SuperScript® VILO™ (Invitrogen) y cuantificación mediante PCR cuantitativa en tiempo real en un LightCycler®480 (Roche). Se utilizaron cebadores para:
– hipoxantina fosforibosiltransferasa-1 -HPRT-1- (5’ – TTGAGTTTGGAAACATCTGGAG – 3’; 5’ – GCCCAAAGGGAACTGATAGTC – 3’), – GJA1 (5’ – ACATGGGTGACTGGAGCGCC – 3’; 5’ – ATGATCTGCAGGACCCAGAA – 3’),
– interleukina-1β-IL-1β- (5’ – CGAATCTCCGACCACCACTAC – 3’; 5’ – TCCATGGCCACAACAACTGA – 3’),
– interleukina-6 -IL-6- (5’ – TGTAGCCGCCCCACACA – 3’; 5’ – GGATGTACCGAATTTGTTTGTA – 3’),
– prostaglandina-endoperóxido sintasa-2 -PTGS2- (5’– CTTCACGCATCAGTTTTTCAAG – 3’; 5’– TCACCGTAAATATGATTTAAGTCCAC – 3’),
– metaloproteasa 3 -MMP-3- (5’– CCCTGGGTCTCTTT CACTCA – 3’; 5’ – GCTGACAGCATCAAAGGACA – 3’),
– inhibidor-2 de quinasa dependiente de ciclina -CDKN2- (5’ – GAGCAGAACGATAGGGCTTG – 3’; 5’ –CAT GTGCCCTCT CCTCCTAA – 3’).

Actividad de las UCs
La comunicación celular a través de uniones comunicantes se evaluó mediante un ensayo Scrape Loading/Dye Transfer (SL/DT). Para ello se realiza un corte sobre células confluentes con un bisturí y la punta de una aguja en presencia del compuesto fluorescente Lucifer Yellow (LY, Cell Projects Ltd© Kent, UK), incubando a 37ºC durante 5 minutos. Las células dañadas que logran reparar la membrana toman del medio el compuesto fluorescente. Se evaluó la transferencia del LY desde la línea de corte en un microscopio de fluorescencia invertido (Nikon Eclipse Ti) y se calculó la ratio entre células no dañadas positivas para LY entre el número de células que toman el compuesto a través de un daño en la membrana.

Senescencia
La senescencia celular se evaluó según la actividad β-galactosidasa con un kit comercial con X-gal como sustrato (Senescence Cells Histochemical Kit, Sigma-Aldrich) y también mediante citometría de flujo con el sustrato di-β-galactopiranósido, que da lugar a fluorescencia verde al ser hidrolizado (Invitrogen). En el caso del X-gal, las células con activadad β-galactosidasa se teñirán de azul verdoso, con lo que se pueden analizar en un microscopio de luz visible. Por otro lado, la hidrólisis del sustrato di-β-galactopiranósido se detectó en un citómetro FACSCaliburTM, y la fluorescencia media se normalizó a los niveles de las células no tratadas.

Análisis estadístico
Para el análisis de los datos se utilizó el programa GraphPad Prism (versión 5.00). Para las variables cuantitativas analizadas se utilizó la t de Student o U de Mann-Whitney. Se consideraron las diferencias estadísticamente significativas ante valores de p<0,05.

Resultados
La Cx43 activa la actividad catabólica en condrocitos de pacientes con OA
En concordancia con lo observado en tejido6, los condrocitos articulares en cultivo primario procedentes de donantes con OA (OAc) presentaron niveles de Cx43 significativamente mayores que aquéllos aislados de donantes sanos (N) detectados por citometría de flujo (Figura 1A). Los niveles elevados de Cx43 se correlacionaron con mayores niveles de comunicación intercelular a través de UCs, cuantificada mediante un ensayo SL/DT de transferencia de LY (Figura 1B). Con el objetivo de estudiar el efecto en el fenotipo celular de niveles elevados de la Cx43 y de comunicación intercelular a través de UCs, se utilizó como modelo de estudio una línea celular de condrocitos de una donante sana, T/C-28a2. La Cx43 fue sobreexpresada utilizando un vector con el gen de la Cx43 humana bajo el promotor del CMV [24] (Figura 1C). El incremento de la Cx43 en la línea celular de condrocitos humanos T/C-28a2 se correlacionó con un aumento de la actividad de las UCs detectada por el ensayo SL/DT (Figura 1D). El ensayo de expresión génica mediante RT-PCR mostró un incremento significativo en la expresión génica de interleuquina 1-β (IL-1β), ciclooxigenasa-2 (COX-2) y metaloproteasa-3 (MMP-3) cuando la Cx43 fue sobreexpresada en la línea de condrocitos sana (T/C – Cx43) (Figura 1E).

Activación desdiferenciación celular en OA

Mediante ensayos de citometría de flujo estudiamos los niveles de marcadores de desdiferenciación celular en condrocitos de pacientes con artrosis y condrocitos aislados de donantes sanos, con el objetivo de confirmar la presencia de condrocitos inmaduros en muestras de cartílago de pacientes con OA. Mediante citometría de flujo, se detectaron mayores niveles del marcador “Stem” CD166 en OAc en cultivo primario en comparación con condrocitos sanos (Figura 2A). En concordancia con estos resultados, el incremento de la Cx43 en condrocitos sanos (línea celular) utilizando un vector de expresión (T/C-Cx43 o línea T/C-28a2 transfectada con un plásmido para sobreexpresar la Cx43) desencadenó en un incremento significativo en los niveles de los dos marcadores “stem-like” CD166 y CD105, respecto a las células control con niveles bajos de Cx43 (T/C-28a2) (Figura 2B).

La disminución de la actividad de la Cx43 y de las UCs activa re-diferenciación celular en OA
Con el objetivo de disminuir la actividad de la Cx43 en OAc, se estudió el efecto de diferentes moléculas en los niveles y actividad de la Cx43. En este estudio, observamos que el polifenol oleuropeína disminuye los niveles de la Cx43 en OAc (Figura 3A). La disminución de los niveles de la Cx43 mejoró el fenotipo del condrocito OA detectado por un incremento en el principal marcador de condrocitos articulares, el colágeno II (Figura 3B). El tratamiento de OAc con una concentración de 10 µM de oleuropeína durante 7 días dio lugar a una disminución significativa de los niveles de marcadores de desdiferenciación CD105 y CD166 (Figura 3C), así como de la expresión génica de IL-1β, IL-6, COX-2 y MMP-3 detectados por citometría de flujo y análisis de la expresión génica respectivamente (Figura 3D). El efecto de la Cx43 en plasticidad celular en OAc fue confirmado en cultivo 3D. La modulación de los niveles de Cx43 en presencia de oleuropeína 10 µM en micromasas y en medio condrogénico mejoró la estructura de la matriz extracelular, detectándose un incremento significativo en los depósitos de colágeno II y proteoglicanos en la matriz de la estructura 3D (Figura 4).

La Cx43 activa TEM y senescencia celular en OAc
La sobreexpresión de la Cx43 en la línea de condrocitos T/C-28a2, se correlacionó con un incremento en el núcleo de PCNA, proteína utilizada como marcador de proliferación celular, y con activación del factor de transcripción relacionado con TEM, Twist-1, detectado por translocación e incremento de los niveles del factor de transcripción a nivel nuclear (Figura 5A). Los condrocitos transfectados para sobreexpresar la Cx43 también mostraron mayores niveles nucleares de NF-kß, uno de los factores de transcripción más importantes en la regulación de síntesis del componente SASP (Figura 5A). Niveles elevados de la Cx43 se correlacionaron con elevados niveles de los factores implicados en senescencia celular p53 (Figura 5B) y p16 (Figura 5C). El tratamiento de OAc con oleuropeína 10 µM redujo los niveles de Cx43 (Figura 3A) y de senescencia celular detectada por la actividad β-galactosidasa mediante microscopía óptica y por citometría de flujo (Figura 5D). Con el objetivo de confirmar el efecto de la disminución de Cx43 en TEM y senescencia celular, se transfectó la línea T/C-28a2 con un plásmido CRISPR/Cas9, obteniendo células heterocigotas para el gen de la Cx43 (Figura 6A). Niveles reducidos de Cx43 en la línea T/C-28a2 se correlacionó con una disminución significativa de los marcadores “stem-like” CD166 y CD105 (Figura 6B). La disminución de los niveles de Cx43 en estas células, desencadenó en una disminución en los niveles de los factores de transcripción Twist-1 (TEM) y NF-kß (SASP) a nivel nuclear (Figura 6C), disminuyendo los niveles de senescencia celular, detectada mediante actividad β-galactosidasa y citometría de flujo (Figura 6D). Los condrocitos T/C-28a2 con bajos niveles de Cx43 (CRISPR-Cx43) mostraron niveles significativamente menores de síntesis de los mediadores pro-inflamatorios IL-1β e IL-6, y de la proteasa MMP-3, con respecto a la línea T/C-28a2 sin transfectar.

Discusión
Durante la artrosis, los condrocitos presentan niveles incrementados de la proteína transmembrana Cx43 [6] y su fenotipo se ve alterado impidiendo que puedan participar en la regeneración del tejido y llevar a cabo su función, desencadenando en la progresiva degeneración del tejido. La desdiferenciación relacionada con fenómenos de transición epitelio-mesénquima (TEM) es un proceso celular que participa en la regeneración de tejidos al permitir a las células desdiferenciarse a un estado más inmaduro para activar procesos entre los que se incluyen proliferación celular y migración, con el objetivo de reemplazar las células dañadas y remodelar la matriz extracelular [25,26]. Sin embargo, cuando esta desdiferenciación ocurre de forma crónica puede ocasionar el desarrollo de fibrosis en el contexto de regeneración tisular [27,28]. En este estudio hemos descrito que los niveles de Cx43 y comunicación intercelular a través de UCs en artrosis se correlacionan positivamente con los marcadores de desdiferenciación celular CD105 y CD166. Además, hemos comprobado que este estado puede ser revertido parcialmente mediante el uso de moléculas que disminuyen los niveles de Cx43, mejorando el fenotipo de los condrocitos artrósicos y de la MEC en ensayos in vitro. La disminución de la Cx43 dio lugar a re-diferenciación celular y, por tanto, a una menor expresión de citoquinas pro-inflamatorias y enzimas degradadoras de la matriz del cartílago articular. Nuestros resultados también ponen de manifiesto que niveles elevados de la Cx43 en condrocitos se relacionan con un incremento en senescencia asociada a una mayor expresión de p16INK4a y altos niveles de p53. Estudios recientes remarcan la importancia de la senescencia en artrosis [29-33]. De hecho, Jeon et al. publicaron un artículo en Nature Medicine donde mostraron la senescencia como una nueva diana terapéutica para tratar la artrosis y promover la regeneración del cartílago [33,34]. En este estudio demostramos por primera vez la relación entre la sobre-actividad de la Cx43 en condrocitos humanos y la activación de desdiferenciación y senescencia celular que desembocan en alteraciones en el proceso de regeneración y favorecen el progreso de la enfermedad. A partir de estos resultados, terapias dirigidas a disminuir los niveles de Cx43 en artrosis surgen como una interesante aproximación terapéutica para la artrosis.
En conclusión, estos hallazgos sugieren que el incremento en la actividad de la Cx43 que se alcanza desde estadios muy tempranos de la OA [6] podría contribuir a la degeneración del cartílago articular y de la articulación al activar desdiferenciación celular vía TEM y senescencia celular, contribuyendo a la síntesis de enzimas que degradan la liberación de citoquinas que contribuyen al proceso degenerativo en la articulación. Estos resultados demuestran que la Cx43 y las UCs actúan como regulador de la desdiferenciación/re-diferenciación y senescencia en condrocitos, probablemente activando proteínas relacionadas con TEM, como Twist-1, y de citoquinas pro-inflamatorias como IL-1β. La disminución en los niveles de Cx43 en OAc promueve su re-diferenciación disminuyendo la expresión de mediadores inflamatorios y senescencia, y a su vez se acompaña de mayor depósito de Col2A1 y proteoglicanos en la matriz extracelular. El uso de moléculas como la oleuropeína y el diseño de estudios que permitan disminuir la actividad de la Cx43 in vivo probablemente constituya un primer paso en el desarrollo de estrategias terapéuticas innovadoras para el tratamiento eficaz de la artrosis desde estadios tempranos de la enfermedad al restaurar la regeneración del tejido.
Agradecimientos: Este trabajo ha sido posible gracias a la financiación obtenida por un proyecto de la Sociedad Española de Investigación Ósea y del Metabolismo Mineral (FEIOMM 2016) y gracias al proyecto PI16/00035 cofinanciado por el ISCIII-Subdirección General de Evaluación y Fomento de la Investigación – Fondo Europeo de Desarrollo Regional (FEDER) “Una manera de hacer Europa” concedidos a M.D.M. También ha sido financiado por un proyecto PRECIPITA (PRECIPITA – 2015 – 000139) otorgado por el Ministerio de Economía y Competitividad y FECYT y un proyecto financiado por la Xunta de Galicia (IN607B, 2017/21) otorgado A M.D.M. Por último, gracias a la concesión de un contrato pre-doctoral de la Xunta de Galicia y una beca de estancia predoctoral de la Universidade da Coruña – INDITEX y de la agrupación CICA-INIBIC a M.V-E.

Conflicto de intereses: Los autores declaran no tener conflictos de intereses.

 

Bibliografía

1. Kapoor M, Martel-Pelletier J, Lajeunesse D, Pelletier JP, Fahmi H. Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol. 2011;7(1):33-42.
2. Loeser RF, Collins JA, Diekman BO. Ageing and the pathogenesis of osteoarthritis. Nat Rev Rheumatol. 2016; 12(7):412-20.
3. Philipot D, Guerit D, Platano D, Chuchana P, Olivotto E, Espinoza F, et al. p16INK4a and its regulator miR-24 link senescence and chondrocyte terminal differentiation-associated matrix remodeling in osteoarthritis. Arthritis Res Ther. 2014;16(1):R58.
4. Mayan MD, Gago-Fuentes R, Carpintero-Fernandez P, Fernandez-Puente P, Filgueira-Fernandez P, Goyanes N, et al. Articular chondrocyte network mediated by gap junctions: role in metabolic cartilage homeostasis. Ann Rheum Dis. 2013.
5. Chi SS, Rattner JB, Matyas JR. Communication between paired chondrocytes in the superficial zone of articular cartilage. J Anat. 2004;205(5):363-70.
6. Mayan MD, Carpintero-Fernandez P, Gago-Fuentes R, Martinez-de-Ilarduya O, Wang HZ, Valiunas V, et al. Human articular chondrocytes express multiple gap junction proteins: differential expression of connexins in normal and osteoarthritic cartilage. Am J Pathol. 2013;182(4):1337-46.
7. Gago-Fuentes R, Bechberger JF, Varela-Eirin M, Varela-Vazquez A, Acea B, Fonseca E, et al. The C-terminal domain of connexin43 modulates cartilage structure via chondrocyte phenotypic changes. Oncotarget. 2016;7(45).
8. Mendoza-Naranjo A, Cormie P, Serrano AE, Wang CM, Thrasivoulou C, Sutcliffe JE, et al. Overexpression of the gap junction protein Cx43 as found in diabetic foot ulcers can retard fibroblast migration. Cell Biol Int. 2012;36(7):661-7.
9. Brandner JM, Houdek P, Husing B, Kaiser C, Moll I. Connexins 26, 30, and 43: differences among spontaneous, chronic, and accelerated human wound healing. J Invest Dermatol. 2004;122(5): 1310-20.
10. Rai MF, Schmidt EJ, McAlinden A, Cheverud JM, Sandell LJ. Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration. G3. 2013;3 (11):1881-91.
11. Rai MF, Sandell LJ. Regeneration of articular cartilage in healer and non-healer mice. Matrix Biol. 2014;39:50-5.
12. Grogan SP, Miyaki S, Asahara H, D’Lima DD, Lotz MK. Mesenchymal progenitor cell markers in human articular cartilage: normal distribution and changes in osteoarthritis. Arthritis Res Ther. 2009;11(3):R85.
13. Kim AC, Spector M. Distribution of chondrocytes containing alpha-smooth muscle actin in human articular cartilage. J Orthop Res. 2000;18(5):749-55.
14. Bae DK, Yoon KH, Song SJ. Cartilage healing after microfracture in osteoarthritic knees. Arthroscopy. 2006;22 (4):367-74.
15. Bank RA, Soudry M, Maroudas A, Mizrahi J, TeKoppele JM. The increased swelling and instantaneous deformation of osteoarthritic cartilage is highly correlated with collagen degradation. Arthritis Rheum. 2000;43(10):2202-10.
16. Barley RD, Adesida AB, Bagnall KM, Jomha NM. Immunohistochemical characterization of reparative tissue present in human osteoarthritic tissue. Virchows Archiv. 2010;456(5):561-9.
17. Heinegard D, Saxne T. The role of the cartilage matrix in osteoarthritis. Nat Rev Rheumatol. 2011;7(1):50-6.
18. Garciadiego-Cazares D, Aguirre-Sanchez HI, Abarca-Buis RF, Kouri JB, Velasquillo C, Ibarra C. Regulation of alpha5 and alphaV Integrin Expression by GDF-5 and BMP-7 in Chondrocyte Differentiation and Osteoarthritis. PLoS One. 2015;10(5):e0127166.
19. Grenier S, Bhargava MM, Torzilli PA. An in vitro model for the pathological degradation of articular cartilage in osteoarthritis. J Biomech. 2014;47(3):645-52.
20. Johnson K, Zhu S, Tremblay MS, Payette JN, Wang J, Bouchez LC, et al. A stem cell-based approach to cartilage repair. Science. 2012;336(6082):717-21.
21. Yano F, Hojo H, Ohba S, Fukai A, Hosaka Y, Ikeda T, et al. A novel disease-modifying osteoarthritis drug candidate targeting Runx1. Ann Rheum Dis. 2013; 72(5):748-53.
22. Kitamura H, Okazaki M. AG-041R, a novel indoline-2-one derivative, stimulates chondrogenesis in a bipotent chondroprogenitor cell line CL-1. Osteoarthritis Cartilage. 2005; 13(4):287-96.
23. Bellesini LS, Beloti MM, Crippa GE, Bombonato-Prado KF, Junta CM, Marques MM, et al. The effect of TAK-778 on gene expression of osteoblastic cells is mediated through estrogen receptor. Exp Biol Med (Maywood). 2009;234(2):190-9.
24. Gangoso E, Thirant C, Chneiweiss H, Medina JM, Tabernero A. A cell-penetrating peptide based on the interaction between c-Src and connexin43 reverses glioma stem cell phenotype. Cell Death Dis. 2014;5:e1023.
25. Cheng F, Shen Y, Mohanasundaram P, Lindstrom M, Ivaska J, Ny T, et al. Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF-beta-Slug signaling. Proc Natl Acad Sci U S A. 2016;113(30):E4320-7.
26. Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453(7193): 314-21.
27. Li M, Luan F, Zhao Y, Hao H, Zhou Y, Han W, et al. Epithelial-mesenchymal transition: An emerging target in tissue fibrosis. Exp Biol Med (Maywood). 2016;241(1):1-13.
28. Ye X, Weinberg RA. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 2015;25(11):675-86.
29. Price JS, Waters JG, Darrah C, Pennington C, Edwards DR, Donell ST, et al. The role of chondrocyte senescence in osteoarthritis. Aging Cell. 2002;1(1):57-65.
30. Zhou HW, Lou SQ, Zhang K. Recovery of function in osteoarthritic chondrocytes induced by p16INK4a-specific siRNA in vitro. Rheumatology (Oxford). 2004;43(5):555-68.
31. Gao SG, Zeng C, Li LJ, Luo W, Zhang FJ, Tian J, et al. Correlation between senescence-associated beta-galactosidase expression in articular cartilage and disease severity of patients with knee osteoarthritis. Int J Rheum Dis. 2016;19(3):226-32.
32. Xu M, Bradley EW, Weivoda MM, Hwang SM, Pirtskhalava T, Decklever T, et al. Transplanted Senescent Cells Induce an Osteoarthritis-Like Condition in Mice. J Gerontol A S Biol Sci Med Sci. 2017;72(6):780-5.
33. Jeon OH, Kim C, Laberge RM, Demaria M, Rathod S, Vasserot AP, et al. Local clearance of senescent cells attenuates the development of post-traumatic osteoarthritis and creates a pro-regenerative environment. Nat Med. 2017; 23(6):775-81.
34. Toh WS, Brittberg M, Farr J, Foldager CB, Gomoll AH, Hui JH, et al. Cellular senescence in aging and osteoarthritis. Acta Orthop. 2016;87(sup363):6-14.